View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2553_low_16 (Length: 227)
Name: NF2553_low_16
Description: NF2553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2553_low_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 227
Target Start/End: Complemental strand, 2161847 - 2161636
Alignment:
| Q |
16 |
ttctagcttgatagggtatctagaattacatctagcttggtagggtatctagcttttgaaatttagaatctagttagtatttcttttattttttacacgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2161847 |
ttctagcttgatagggtatctagaattacatctagcttggtagggtatctagcttttgaaatttagaatctagttagtatttcttctattttttacacgg |
2161748 |
T |
 |
| Q |
116 |
caaatattattcacgtcttcttaatgcaagaagcatatgagtactcatattcttgcacaccttgtgcttgaatgtgtctatttcaataaaattgtttgtt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2161747 |
gaaatgttattcacgtcttcttaatgcaagaagcatatgagtactaatattcttgcacaccttgtgcttgaatgtgtctatttcaataaaattgtttgtt |
2161648 |
T |
 |
| Q |
216 |
ttattcatgcaa |
227 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
2161647 |
ttatccatgcaa |
2161636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University