View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2553_low_4 (Length: 394)
Name: NF2553_low_4
Description: NF2553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2553_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 3970759 - 3970891
Alignment:
| Q |
1 |
ctcgccaccgtcaccggcttcctcaccacctcctcctttctctccccctccggcgaaatcaacgccaccaccctccgtcgtctcatccctcattcttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||| || |||| |
|
|
| T |
3970759 |
ctcgccaccgtcaccggcttcctcaccacctcctcctttctctccccctccggcgatatcaacatcaccaccctccgtcgtctcgtccctcactcctcct |
3970858 |
T |
 |
| Q |
101 |
ccctcctcggttggttctcc-ggtcgccgccgt |
132 |
Q |
| |
|
||||||| |||||||||||| |||||||||||| |
|
|
| T |
3970859 |
ccctccttggttggttctccgggtcgccgccgt |
3970891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 3971066 - 3971134
Alignment:
| Q |
310 |
ccaatttcagatcaatcctcacacattcacacacatgattaccgtgtttatcaatttctaaccgaatcc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3971066 |
ccaatttcagatcaatcctcacacattcacacacatgattaccgtgtttatcaatttctatccgaatcc |
3971134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University