View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2553_low_7 (Length: 320)
Name: NF2553_low_7
Description: NF2553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2553_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 66 - 307
Target Start/End: Complemental strand, 31636105 - 31635864
Alignment:
| Q |
66 |
cattactattgaatgcaactaataaacaaaatgaaagtaacacacaaacacctccaccatggatattaatttaagaaaatgaaagtaaattaaatattcg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31636105 |
cattactattgaatgcaactaataaacaaaatgaaagtaacacacaaacaccaccaccactgatattaatttaagaaaataaaagtaaattaaatattcg |
31636006 |
T |
 |
| Q |
166 |
tgtcaatgttgaatagacacatgtggttatcggatattccttcaatccgagttgtgtgtgatacacagaacacaactcatttgtacaacagttcattgac |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
31636005 |
tgtcaatgttgaatagacacatgtggttatcggatattccttcaatccgagttgtgtgtgatacacggaacacaactcatttgtacaatagttcattgac |
31635906 |
T |
 |
| Q |
266 |
atctgggctcggccttcaaccaccatgacaattgtcatatct |
307 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31635905 |
atctgggctcggccttcaaccaccgtgacaattgtcatatct |
31635864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University