View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2553_low_8 (Length: 308)
Name: NF2553_low_8
Description: NF2553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2553_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 10 - 277
Target Start/End: Original strand, 36594198 - 36594453
Alignment:
| Q |
10 |
aagaatatatgtggtatttaaatatgatttttcattaagattataaatataggtggcttgtagaaacacgtattaacctcaaatagatgagattagagga |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36594198 |
aagaaaatatgtggtatttaaatatgatttttcattaagattataaataaaggtggcttgtagaaacacgtattaacctcaaacagatgagattagagga |
36594297 |
T |
|
| Q |
110 |
acgggataaactcccataatacagtgaaccaatgtttgaatcttgtaggtaagactaacgcacaatctatatggatttaatatttatttttgataaaaat |
209 |
Q |
| |
|
||| || ||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36594298 |
acgaga------------atacagtgaaccaatgtttgaattttataggtaagactaacgcgcaatctatatggatttagtatttatttttgataaaaat |
36594385 |
T |
|
| Q |
210 |
cggtatacttattgttgtttgaccacctctctgtatcagcaaacacatgtagattgcaaggtagactt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36594386 |
cggtatacttattgttgtttgaccacctctgtgtatcagcaaacacatgtagattgcaaggtagactt |
36594453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University