View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2554_high_17 (Length: 242)

Name: NF2554_high_17
Description: NF2554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2554_high_17
NF2554_high_17
[»] chr4 (1 HSPs)
chr4 (46-174)||(55061495-55061623)
[»] chr2 (2 HSPs)
chr2 (46-166)||(40931607-40931728)
chr2 (47-169)||(40939574-40939699)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 46 - 174
Target Start/End: Original strand, 55061495 - 55061623
Alignment:
46 gttcattttgtttctcttctcttaatttaccaaaatgaaattcttgatgtgcatgtgtcatagatcgatcaaaggttgttttttgtattgatgggcttgt 145  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
55061495 gttcattttgtttcttttctcttaatttaccaaaatgaaattcttgatgtgcatgtgtcatagatcgaacaaaggttgttttttgtattgatgggcttgt 55061594  T
146 ttgatcttcatcatgcaaattgttaatgc 174  Q
    |||||||||||||||||||||||||||||    
55061595 ttgatcttcatcatgcaaattgttaatgc 55061623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 46 - 166
Target Start/End: Original strand, 40931607 - 40931728
Alignment:
46 gttcattttgtttctcttctcttaatttaccaaaatgaaattcttgatgtgcatgtgtcatagatcgatcaaaggtt-gttttttgtattgatgggcttg 144  Q
    |||||||||||||||| ||| ||| |||||||||||| ||| ||||||||| ||||||| ||| |||| ||||||||  |||||| ||||||||||||||    
40931607 gttcattttgtttctcatcttttactttaccaaaatgcaatgcttgatgtggatgtgtcgtagctcgaccaaaggttaattttttttattgatgggcttg 40931706  T
145 tttgatcttcatcatgcaaatt 166  Q
    |||| |||||||||| ||||||    
40931707 tttgttcttcatcatacaaatt 40931728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 47 - 169
Target Start/End: Original strand, 40939574 - 40939699
Alignment:
47 ttcattttgtttctcttctcttaatttaccaaaatgaaattcttgatgtgcatgtgtcatagatcgatcaaaggttgttt---tttgtattgatgggctt 143  Q
    ||||||||||||||| | | ||| |||||||||||||| || |||| ||| |||||||||||||||||||||||||||||   ||| |||||||| ||||    
40939574 ttcattttgtttctcatattttactttaccaaaatgaatttgttgaggtggatgtgtcatagatcgatcaaaggttgtttttatttttattgatgagctt 40939673  T
144 gtttgatcttcatcatgcaaattgtt 169  Q
    ||||  ||||||| ||||||||||||    
40939674 gtttattcttcatgatgcaaattgtt 40939699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University