View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2554_high_19 (Length: 241)
Name: NF2554_high_19
Description: NF2554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2554_high_19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 241
Target Start/End: Original strand, 45460358 - 45460583
Alignment:
| Q |
16 |
atgtcaactggttattgatgattttcagtctagctgtgacggttggtttcagagacatggtgaagattggcaacgcaacaagtatgccannnnnnncatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45460358 |
atgtcaactggttattgatgattttcagtctagctgtgacggttggtttcagagacatggtgaagattggcaacgcaacaagtatgccatttttttcatt |
45460457 |
T |
|
| Q |
116 |
tctcttggtgttaattaatgnnnnnnncttgagttattaatcaagagagtagctcccatttttgcattaaactagaaaatgaagagaagtcttnnnnnnn |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45460458 |
tctcttggtgttaattaatgtttttttcttgagttattaatcaagagagtagctcccatttttgcattaaactagaaaatgaagggaagtcttaaaaaaa |
45460557 |
T |
|
| Q |
216 |
tgaaaacttggtaaactaaacaggga |
241 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
45460558 |
tgaaaagttggtaaactaaacaggga |
45460583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University