View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2554_low_18 (Length: 250)
Name: NF2554_low_18
Description: NF2554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2554_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 39671621 - 39671861
Alignment:
| Q |
1 |
catgatttgagtcattggtgaaatcatccacttggtgaaaacatcaaccacgtgaatggtttaatgttttgttgttagcttgtggtctacttcaagacac |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39671621 |
catgatttgagtcatcggtgaaatcatccacttggtgaaaacatcaaccacgtgaatggtttaatgttttgttgttagcttgtggtctacttcaagacac |
39671720 |
T |
|
| Q |
101 |
acaccaacagaatgatgaagccaatatcctcagtgatgaatcctgtggaacctaatatcgaatatcgttaagagccctaatccattaatcccaaaagaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
39671721 |
acaccaacagaatgatgaagccaatatcctcggtgatgaatcctgtggaacctaatatcgaatatcgttaaaagccctaatccattaatcacaaaagaaa |
39671820 |
T |
|
| Q |
201 |
gcacatcagtacaagaagacaaatattaatcctgcctttgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39671821 |
gcacatcagtacaagaagacaaatatt-atcctgcctttgct |
39671861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University