View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2554_low_21 (Length: 241)
Name: NF2554_low_21
Description: NF2554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2554_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 10 - 216
Target Start/End: Original strand, 13712906 - 13713112
Alignment:
| Q |
10 |
agcaaaggaagattaatagaacaatgaaacatagtggcaacacgaatatgcgacaatgtcagattcacaagggttttgcagcagaagatggtaggtgcca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
13712906 |
agcaaaggaagattaatagaacaatgaaacatagtggcaacacgaataagcgtcaatgtcaggttcacaagggttttgcagcagaagattgtaggcgcca |
13713005 |
T |
|
| Q |
110 |
aagggacgtgtaaaaaatatggaaagtgtagacggagaacctcaatgtggcggtgttttgcagcttcaacccatctgtagaaacagtcactctcattctc |
209 |
Q |
| |
|
||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
13713006 |
aagggacgtataaaaaatatgaaaagtgcagacggagaacctcaatgtggcggtgttttgccgcttcaacccatctgttgaaatagtcactctcattctc |
13713105 |
T |
|
| Q |
210 |
ccagagt |
216 |
Q |
| |
|
||||||| |
|
|
| T |
13713106 |
ccagagt |
13713112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 121
Target Start/End: Complemental strand, 19805667 - 19805621
Alignment:
| Q |
75 |
cacaagggttttgcagcagaagatggtaggtgccaaagggacgtgta |
121 |
Q |
| |
|
|||||| |||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
19805667 |
cacaagtgttttgcagcagaagacagtaggtgctaaagggacgtgta |
19805621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University