View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2554_low_24 (Length: 240)
Name: NF2554_low_24
Description: NF2554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2554_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 29 - 220
Target Start/End: Complemental strand, 34450406 - 34450216
Alignment:
| Q |
29 |
cctttactctttttatccaaataatgtacaaaatctatctgttttttcaactattttatgtgttctttattattcctatcgatctcctggttggagttga |
128 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34450406 |
cctttactctttt-atccaaataatgtacaaaatctatctgttttttcaactattttctgtgttctttattattcctatcgatctcctggttggagttga |
34450308 |
T |
|
| Q |
129 |
ttgaaacggaacaccttaaaacaaatagtcattcaaacaaaaagttttttaaggattaagtgactttgtagataaaaagtatgacaacttta |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34450307 |
ttgaaacggaacaccataaaacaaatagtcattcaaacaaaaacttttttaaggattaagtgactttgtagataaaaaatatgacaacttta |
34450216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University