View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2554_low_29 (Length: 225)
Name: NF2554_low_29
Description: NF2554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2554_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 29935085 - 29935287
Alignment:
| Q |
1 |
tgcaattttttgtatcgagtctgtgttttttatttcttacaccgaacgagttttatgtttcaaaaatttggtatcactctctgctatttattagnnnnnn |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29935085 |
tgcaattttttgtattgagtctgtgttttttatttcttacaccgaacgagttttatgtttcaaaaatttggtatcactctctgctattta---gtttttt |
29935181 |
T |
 |
| Q |
101 |
ngtctactttttgtagctatatatttgcatgtattgttatttcctttgccaatgctaattaatagtaaataattgtgaaagtgatagaatgtatgtagtt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29935182 |
tgtctaatttttgtagctatatatttgcatgtattattatttcctttgccaatgctaattaatagtaaataattgtgaaagtgatagaatgtatgtagtt |
29935281 |
T |
 |
| Q |
201 |
gcgaac |
206 |
Q |
| |
|
|||||| |
|
|
| T |
29935282 |
gcgaac |
29935287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 197
Target Start/End: Complemental strand, 51147764 - 51147731
Alignment:
| Q |
164 |
agtaaataattgtgaaagtgatagaatgtatgta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51147764 |
agtaaataattgtgaaagtgatagaatgtatgta |
51147731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University