View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2554_low_4 (Length: 398)
Name: NF2554_low_4
Description: NF2554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2554_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 384; Significance: 0; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 1 - 392
Target Start/End: Original strand, 40898933 - 40899324
Alignment:
| Q |
1 |
ccaccgcaggccggtgaagtccgtctcaagatactcttcacctccctttgtcacactgatgtttacttctgggaagctaaggtatattactaattaacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40898933 |
ccaccgcaggccggtgaagtccgtctcaagatactcttcacctccctttgtcacaccgatgtttacttctgggaagctaaggtatattactaattaacca |
40899032 |
T |
|
| Q |
101 |
cacacacattttctgtctatttgtctatgagaaaagttatttcgacaacccaaaaaattcataagagaattttctcttatgtagtttggtttgattacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40899033 |
cacacacattttctgtctatttgtctatgagaaaagttatttcgacaacccaaaaaattcataagagaattttctcttatgtagtttggtttgattacat |
40899132 |
T |
|
| Q |
201 |
aacacgttggggtgcttagtttctaacaaaaaagttaatttatgtaaaattcttctcgggtttaattttagttagaacatattagcttcctggtttttgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40899133 |
aacacgttggggtgcttagtttctaacaaaaaagttaatttatgtaaaattcttctcgggtttaattttagttagaacatattagcttcctggtttttgg |
40899232 |
T |
|
| Q |
301 |
tttagttttataaaaaggttttgatgttctgttgtgcattgcagtgatttaatatggttttcccttgtttcagggtcagactcctttgtttc |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40899233 |
tttagttttataaaaaggttttgatgttctgttgtgcattgcagtgatttaatatggttttcccttgtttcagggtcagactccattgtttc |
40899324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 40880008 - 40880096
Alignment:
| Q |
1 |
ccaccgcaggccggtgaagtccgtctcaagatactcttcacctccctttgtcacactgatgtttacttctgggaagctaaggtatatta |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40880008 |
ccaccgcaggccggtgaagtccgtctcaagatactcttcacctctctttgtcacactgatgtttacttctgggaagctaaggtatatta |
40880096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 40903609 - 40903693
Alignment:
| Q |
1 |
ccaccgcaggccggtgaagtccgtctcaagatactcttcacctccctttgtcacactgatgtttacttctgggaagctaaggtat |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40903609 |
ccaccgcaggccggtgaagtccgtctcaagatactcttcacctccctttgtcacactgatgtttacttctgggaagctaaggtat |
40903693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 316 - 392
Target Start/End: Original strand, 40903765 - 40903849
Alignment:
| Q |
316 |
aggttttgatgttctgttgtgcattgcagtgatttaatatg--------gttttcccttgtttcagggtcagactcctttgtttc |
392 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
40903765 |
aggttttcatgttctgttttgcattgcagtgatttaatatggttttcttgttttcctttgtttcagggtcagactccattgtttc |
40903849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 190 - 256
Target Start/End: Original strand, 40903697 - 40903763
Alignment:
| Q |
190 |
tttgattacataacacgttggggtgcttagttt-ctaacaaaaaagttaatttatgtaaaattcttct |
256 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| || ||| ||||||||||||||||||||||||||| |
|
|
| T |
40903697 |
tttgattacataacacggcggg-tgcttagttttcttacacaaaagttaatttatgtaaaattcttct |
40903763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University