View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2554_low_8 (Length: 341)
Name: NF2554_low_8
Description: NF2554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2554_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 292
Target Start/End: Complemental strand, 43555679 - 43555403
Alignment:
| Q |
11 |
catcatcatcaaatggcagaagcacgttctaatgaatcgcttgaaatcacaaacgaaaatgagttcacagaaaaggaagctgctgagcaacttattcagc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43555679 |
catcatcatcaaatggcagaagcacgttctaatgtatcgcttgaaatcacaaacgaaaatgagttcacagaaaaggaagctgctgagcaacttattcagc |
43555580 |
T |
 |
| Q |
111 |
tgagcaatgaagttaggatcagtagcagcaagaggaatatgattacattggaaaaaggattggagttggttgatgaagccataactaagattgaatctta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
43555579 |
tgagcaatgaagttaggatcagtagcagcaagaggaatatgattacattggaaaaaggattggagttggttgatgaatccataactaagattgaatctca |
43555480 |
T |
 |
| Q |
211 |
tcagccaaaggaaagaatcatcattatgagaagaagaaatttcgatctcttgttgatatttacgtggagactgcccccaaat |
292 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||| |||| ||||| ||||| |||||||||||| |
|
|
| T |
43555479 |
tcagcc-----aaagaatcatcattatgagatgaagaaatttcgatctcttaatgatgtttacatggaggctgcccccaaat |
43555403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University