View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2554_low_9 (Length: 301)
Name: NF2554_low_9
Description: NF2554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2554_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 61 - 286
Target Start/End: Complemental strand, 15995641 - 15995416
Alignment:
| Q |
61 |
acatgtaatttttaattnnnnnnnnttaaaactttgcttcctcttcttttatcgtaagccagtaatcacctcatagcttcatcttcctcaatcgtatccc |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15995641 |
acatgtaatttttaattaaaaaaaattaaaactttgcttcctcttcttctatcgtaagccagtaatcacctcatagcttcatcttcctcaatcgtatccc |
15995542 |
T |
|
| Q |
161 |
tcaccgccatacctaaccaccgttgcttctcttctcttccgcaccagtcttttcatttaccgacttttactgtaaaatataattatgtctcttattctgt |
260 |
Q |
| |
|
||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15995541 |
tcagcgccatatctaaccaccgttgcttctcttctcttccacaccagtcttttcatttacccactttcactgtaaaatataattatgtctcttattctgt |
15995442 |
T |
|
| Q |
261 |
cacttttacccttgccagtctctttt |
286 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
15995441 |
cacttttacccttgccagtctctttt |
15995416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 11 - 73
Target Start/End: Complemental strand, 1856728 - 1856666
Alignment:
| Q |
11 |
gatgaatgacttatggcaaaaaaggattcaacagttcagatttaaaataaacatgtaattttt |
73 |
Q |
| |
|
|||||||||| | |||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1856728 |
gatgaatgacatgtggcaaaaaaggattcaatggttcagatttaaaataaacatgtatttttt |
1856666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 229 - 274
Target Start/End: Original strand, 55203685 - 55203730
Alignment:
| Q |
229 |
actgtaaaatataattatgtctcttattctgtcacttttacccttg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55203685 |
actgtaaaatataattatgtctcttattctgccacttttacccttg |
55203730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 230
Target Start/End: Original strand, 55203585 - 55203645
Alignment:
| Q |
170 |
tacctaaccaccgttgcttctcttctcttccgcaccagtcttttcatttaccgacttttac |
230 |
Q |
| |
|
|||| ||||||| ||| |||||||||||||| |||||| | |||||||||| |||||||| |
|
|
| T |
55203585 |
taccaaaccaccattgtttctcttctcttccacaccagacgattcatttacccacttttac |
55203645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University