View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2555_high_16 (Length: 247)
Name: NF2555_high_16
Description: NF2555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2555_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 8872464 - 8872695
Alignment:
| Q |
1 |
ttattttggttctagtaaaagactgatttataacttcgtttttaaaggaaaaactggcatgattccaaccattctaccctagttcaaatcaacccccaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8872464 |
ttattttggttctagtaaaagactgatttataacttcgtttttaaaggaaaaactggcatgattccaaccactctaccctagttcaaatcaacccccaca |
8872563 |
T |
|
| Q |
101 |
ataacacatgatctagtttttaagtacattattcaaatatacttaccctgattttaatcaacccatttattcacttaactcaaatttttgttgcagatac |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
8872564 |
ataacacctgatctagtttttaagtacattattcaaatatacttaccctgattttaatcaacccatttattcacttaacttaaatttttattgcagatac |
8872663 |
T |
|
| Q |
201 |
tatcatcgctatctggataggtgagttctctt |
232 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |
|
|
| T |
8872664 |
tatcatcactatctggataggtgagttctctt |
8872695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 9095070 - 9095134
Alignment:
| Q |
165 |
atttattcacttaactcaaatttttgttgcagatactatcatcgctatctggataggtgagttct |
229 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||| | |||| ||||||||||||||| |
|
|
| T |
9095070 |
atttattcacttaaatcaattttttgttgcagatgctatcacccttatcaggataggtgagttct |
9095134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University