View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2555_low_12 (Length: 276)
Name: NF2555_low_12
Description: NF2555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2555_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 29058612 - 29058365
Alignment:
| Q |
1 |
aatatgaagaatgttttgatcatgatgggaagttccattgttgtgcaactaagaaaattaagaggttgttat----gtgctatatgaattgtgaatgagt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29058612 |
aatatgaagaatgttttgatcatgatgggaagttccattgttgtgcaactaagaaaattaagaggttgttattatggtgctatatgaattgtgaatgagt |
29058513 |
T |
 |
| Q |
97 |
atgtatatgcattactttgaatttcataggcttatatatagtaatggatagagtatgaacaacgaggaaggacgattagaaagctgataatttaaaacta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29058512 |
atgtatatgcattactttgaatttcataggcttatatatagtaatggatagagtatgaacaacgaaaaaggacgattagaaagctgataatttaaaacta |
29058413 |
T |
 |
| Q |
197 |
ggtatatgcatgctagcttgccgttttggccatcattttataaaataattaa |
248 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29058412 |
ggta----catgctagcttgccgttttggccatcattttataaaataattaa |
29058365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University