View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2555_low_13 (Length: 263)
Name: NF2555_low_13
Description: NF2555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2555_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 32465395 - 32465646
Alignment:
| Q |
20 |
actacttccaagtcgcatttaatcatgcaacatgcttcc-------cattaatgatttatgcatttttgagatgaagagggagagagtgagagagtataa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32465395 |
actacttccaagtcgcatttaatcatgcaacatgcttcccaattcccattaatgatttatgcatttttgagatgaagagggagagaatgagagagtataa |
32465494 |
T |
 |
| Q |
113 |
tgtggtatgctgctggttaagatggtctaaaatggctcatcaaatttgatttatttctatattatttcaaagctaatacgtagg---nnnnnnnnncttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32465495 |
tgtggtatgctgctggttaagatggtctaaaatggctcatcaaatttgatttatttctatattatttcaaagctaatacgtaggtttttttttcttcttg |
32465594 |
T |
 |
| Q |
210 |
tatgtatcttcattattcaagcatttatatttaataccaactatagtctgtg |
261 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
32465595 |
tatgtatcttcatgattcaagcatttatattttataccaactatagtttgtg |
32465646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University