View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2555_low_18 (Length: 243)
Name: NF2555_low_18
Description: NF2555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2555_low_18 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 186 - 243
Target Start/End: Original strand, 4031794 - 4031851
Alignment:
| Q |
186 |
caagtaatagatcttaaatgttccaagaaaaaatcagagggatacttgaaaaacacga |
243 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031794 |
caagtaatagatcttagatgttccaagaaaaaatcagagggatacttgaaaaacacga |
4031851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 48
Target Start/End: Original strand, 4031623 - 4031656
Alignment:
| Q |
15 |
aattctccattttaattgatgatggatgattaac |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4031623 |
aattctccattttaattgatgatggatgattaac |
4031656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University