View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_high_17 (Length: 402)
Name: NF2557_high_17
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 20 - 388
Target Start/End: Complemental strand, 37488312 - 37487944
Alignment:
| Q |
20 |
accagatcaagtgaacatgaacaagttggtgggtgagatagtgaatttggtttgtgaagattgggtggtgatagaaactgtggtgattgttgaagtgaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37488312 |
accagatcaagtgaacatgaacaagttggtgggtgagatagtgaatttggtttgtgaagattgggtggtgatagaaactgtggtgattgttgaagtgaat |
37488213 |
T |
 |
| Q |
120 |
gagtttaaggagagattagggtgtatggaatttggagaagctgttgaattggtttgttgtttgaagaggttggaagagtgtaaagagagggtggtgatga |
219 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37488212 |
gagtttaaggagagattagggtgtttggaatttggagaagctgttgaattggtttgttgtttgaagaggttggaagagtgtaaggagagggtggtgatga |
37488113 |
T |
 |
| Q |
220 |
ttttggagtcacaacaggggttgtgggattcggtgagagaggtgaaggataaggttggaatggaggtgtataaggaaaagggtaaggtgcataaggaggg |
319 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37488112 |
ttttggagtcacaacaggggttatgggattcggtgagagaggtgaaggataaggttggtatggaggtgtataaggaaaagggtaaggtgcataaggaggg |
37488013 |
T |
 |
| Q |
320 |
aagaaagtcaaggtttagtgagtctgatcggttttctgctagagttataagttctcgtgattccctttg |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37488012 |
aagaaagtcaaggtttagtgagtctgatcggttttctgctagagttatcagttctcgtgattccctttg |
37487944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University