View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_high_26 (Length: 344)
Name: NF2557_high_26
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 21078574 - 21078245
Alignment:
| Q |
1 |
gacatatccaagagtatatgtgctgcattaagaagttcatgatcaatcatatttcttctcacgatgctgcgctttttctttttatgggaacttggaggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
21078574 |
gacatatccaagagtatatgtgctgcattaagaagttcatgatcaatcatatttcttctcacgatgctgcgttttttctttttatgggaacttggaggca |
21078475 |
T |
|
| Q |
101 |
aatatttggataagttaataactggtggtgcatcatccacttgaaactgatcaagatcacacatatcactctgttgctccaagaaggagacagggaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21078474 |
aatatttggataagttaataactggtggtgcatcatccacttgaaactgatcaagatcacacatatcactctgttgctccaagaaggagacagggaagaa |
21078375 |
T |
|
| Q |
201 |
ggatgtggttggagactcaatacccttttcgcggtgcgatctcatgttggaaggaaaaaccttatcatggtcaagaaaagcatgcttctgcttcctatga |
300 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
21078374 |
ggatgtggtcggagactcaatacccttttcgcagtgcgatctcatgttggacggaaaaaccttatcatagtcaagaaatgcatgcttctgcttcctatga |
21078275 |
T |
|
| Q |
301 |
tcatcaagaacatcatgtttatgtttcttg |
330 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |
|
|
| T |
21078274 |
tcatcaagaacatcatgtttctgtttcttg |
21078245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 3073725 - 3073780
Alignment:
| Q |
1 |
gacatatccaagagtatatgtgctgcattaagaagttcatgatcaatcatatttct |
56 |
Q |
| |
|
|||||||| |||||| ||| |||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
3073725 |
gacatatcgaagagtgtatatgctccattaagatgttcatgatcaatgatatttct |
3073780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University