View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_high_3 (Length: 649)
Name: NF2557_high_3
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 2e-88; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 2e-88
Query Start/End: Original strand, 115 - 357
Target Start/End: Complemental strand, 30338351 - 30338099
Alignment:
| Q |
115 |
gaagaaaattagaaagtgagatagatccggtagtggg-atctggttatggttttgatacggatctgagttattttatgattgcttgaattgaaatgaagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30338351 |
gaagaaaattagaaagtgagatagatccggtagtggggatctggttatggttttgatacggatctgagttattttatgattgcttgaattgaaatgaagc |
30338252 |
T |
|
| Q |
214 |
tgatggagagagaaccttcgatgcaagatccccaaacacggtttttgctactttacgcattttgtattatcattcg---------nnnnnnnnnnnnnaa |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30338251 |
tgatggagagagaaccttcgatgcaagatccccaaacacggtttttgctactttacgcattttgtattatcattcgtttttttgttttttttttttttaa |
30338152 |
T |
|
| Q |
305 |
ttctggctttgtgagtttttgcgactttcgaaacataaggttagcaattttaa |
357 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30338151 |
ttctggctttgtgagtttttgctactttcgaaacataaggttagcaattttaa |
30338099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 6e-51
Query Start/End: Original strand, 403 - 512
Target Start/End: Complemental strand, 30338080 - 30337970
Alignment:
| Q |
403 |
tctaaattaactcaagtctttgcactttatgtataaatgtgacaactaaattactttctctaaaaacaaactattagtgctaaattact-ttttatgtat |
501 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30338080 |
tctaaattaactcaagtctttgcactttatgtataaatgtgacaactaaattactttctctaaaaacaaactattagtgctaaattacttttttatgtat |
30337981 |
T |
|
| Q |
502 |
agatgtatact |
512 |
Q |
| |
|
||||||||||| |
|
|
| T |
30337980 |
agatgtatact |
30337970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 535 - 599
Target Start/End: Complemental strand, 30337985 - 30337928
Alignment:
| Q |
535 |
tgtatagatgtatactaaattacaatgggtttatatttatatagagtgctcgtgtgatgtacacc |
599 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30337985 |
tgtatagatgtatactaaattacaatgg-------tttatatagagtgctcgtgtgatgtacacc |
30337928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University