View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_high_37 (Length: 285)
Name: NF2557_high_37
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_high_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 74 - 272
Target Start/End: Complemental strand, 4437305 - 4437107
Alignment:
| Q |
74 |
aagcctaatttgaattttgaaacttcaaaattcagtttcttaactactaattaagcagcagcaaccgtccctgtacgaaaagagtaatcttgtgctttgt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4437305 |
aagcctaatttgaattttgaaacttcaaaattcagtttcttaactactaattaagcagcagcaaccgtccctgtacgaaaagagtaatcttgtgctttgt |
4437206 |
T |
|
| Q |
174 |
ttggtgatgaagattttctttgctcnnnnnnnctcaaagccattgatgaagcaatgttcatattcttctctttcgcttcatcaatctctatttgttctt |
272 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4437205 |
ttggtgatgaagattttctttgctctttttttctcaaagccattgatgaagcaatgttcatattcttctctttcgcttcatcaatctctatttgttctt |
4437107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 218 - 272
Target Start/End: Original strand, 40966544 - 40966598
Alignment:
| Q |
218 |
gatgaagcaatgttcatattcttctctttcgcttcatcaatctctatttgttctt |
272 |
Q |
| |
|
||||||| || ||||||||||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
40966544 |
gatgaagaaaggttcatattcttctccttcaattcatctatctctatttgttctt |
40966598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University