View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2557_high_47 (Length: 238)

Name: NF2557_high_47
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2557_high_47
NF2557_high_47
[»] chr8 (2 HSPs)
chr8 (142-238)||(9965002-9965098)
chr8 (18-79)||(9965127-9965188)


Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 142 - 238
Target Start/End: Complemental strand, 9965098 - 9965002
Alignment:
142 gaatttcaaatcagatgcacggagaatctaccgcaataccttagttgaggatgttttgatattgaacttgtagaagataaagattacgtctcatcac 238  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||    
9965098 gaatttcaagtcagatgcacggagaatctaccacaataccttagttgaggttgttttgatattgaacttgtagaagataaagattgcgtctcatcac 9965002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 9965188 - 9965127
Alignment:
18 taaaattcatatgtttttaggggaaaaacaattaaatgaagaacattcattataattttaga 79  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
9965188 taaaattcatatatttttaggggaaaaacaattaaatgaagaacattcattataattttaga 9965127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University