View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_high_49 (Length: 238)
Name: NF2557_high_49
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_high_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 37650034 - 37649827
Alignment:
| Q |
20 |
cgatgttcttcagaaagctatctctgatgaatatttgaggtannnnnnnnnn-----catttagatttttattgaaattacggtaaccttaatatttggt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37650034 |
cgatgttcttcagaaagctatctctgatgaatatttgaggtatttttttttttttttcatttagatttttattgaaattaccgtaaccttaatatttggt |
37649935 |
T |
 |
| Q |
115 |
attatcttgggatactgataattgtttttgtgttgttgatgataggtttgaaccttacttgcagaatgcctgcaaaaggtttgttatggagcttaagccg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37649934 |
attatcttgggatactgataattgtttttgtgttgttgatgataggtttgaaccttacttgcagaatgcctgcaaaaggtttgttatggagcttaagccg |
37649835 |
T |
 |
| Q |
215 |
acgttcat |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
37649834 |
acgttcat |
37649827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University