View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2557_high_52 (Length: 230)

Name: NF2557_high_52
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2557_high_52
NF2557_high_52
[»] chr4 (1 HSPs)
chr4 (16-212)||(53171778-53171974)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 212
Target Start/End: Complemental strand, 53171974 - 53171778
Alignment:
16 agagatggataaagagaagtggaaaatgccagaggaagaagaagaacaagaggaagagttctggggttttgaggatctggaatatgaatatgacagttcc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53171974 agagatggataaagagaagtggaaaatgccagaggaagaagaagaacaagaggaagagttctggggttttgaggatctggaatatgaatatgacagttcc 53171875  T
116 ttttcaatgtctttaattgattcaattgaaagtaattaattaggacaaagtagttaggcaagcgcattgagttacatatgtatgtatatacatgtct 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53171874 ttttcaatgtctttaattgattcaattgaaagtaattaattaggacaaagtagttaggcaagcgcattgagttacatatgtatgtatatacatgtct 53171778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University