View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_high_53 (Length: 225)
Name: NF2557_high_53
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_high_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 209
Target Start/End: Complemental strand, 3949576 - 3949389
Alignment:
| Q |
16 |
tgaagtctaaacctttgaatcaagatcagatagaccatgctctgactttaataagtggattccataatgataatacaaaaggttaaaacttgagctttct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3949576 |
tgaagtctaaacctttgaatcaagatcagatagaccatgctctgactttaataagtggattccattgtgataatacaaaaggttaaaacttgagctttct |
3949477 |
T |
|
| Q |
116 |
tatcttgatccgccggaacatattatcaacaatgtatgattgagttcatacaaaaaactcaaactcaaactcaaatgaattctaagtaagaact |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3949476 |
tatcttgatccgccggaacatattatcaacaatgtgtgattgcgttcatacaaaaaactcaaactcaaac------gaattctaagtaagaact |
3949389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University