View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_high_54 (Length: 219)
Name: NF2557_high_54
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 39292918 - 39292792
Alignment:
| Q |
18 |
catagttcaagaaaattaagataagtaaacacactagagagagatatggctgccaataatgaaaagaaagagcaaaacattcatctccctcacgaaacta |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39292918 |
catagtccaagaaaattaagataagtaaacacactagagagagatatggctgccaataatgaaaagaaagagcaaaacattcatctccctcacgaaacta |
39292819 |
T |
 |
| Q |
118 |
tccttaagagtgatgcactacatcagg |
144 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39292818 |
tccttaagagtgatgcactacatcagg |
39292792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 208
Target Start/End: Complemental strand, 39292782 - 39292740
Alignment:
| Q |
166 |
ctactattcttttccatcttcttctaccgtaaatattcttcga |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| || ||||| |
|
|
| T |
39292782 |
ctactattcttttccttcttcttctaccgtaaatcttgttcga |
39292740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University