View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2557_high_55 (Length: 210)

Name: NF2557_high_55
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2557_high_55
NF2557_high_55
[»] chr3 (1 HSPs)
chr3 (18-196)||(31268405-31268583)


Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 31268405 - 31268583
Alignment:
18 aaactaacacatggtttttcgttccacacactctgacacatagtttttcactaattcaaccttggggatcatcataggttcgataaggtggcatcacaat 117  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
31268405 aaactaacacatggtttttcgttccacacactgtgacacatagtttttcactagttcaaccttggggatcatcataggttcgataaggtggcatcacaat 31268504  T
118 aacttcagtaagtaacgttactttaagaattttgattaaatattaatatgaaggggagttttgacgcaatgataatatt 196  Q
     ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31268505 gacttcagtaagtaacgttactttgagaattttgattaaatattaatatgaaggggagttttgacgcaatgataatatt 31268583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University