View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_high_56 (Length: 210)
Name: NF2557_high_56
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_high_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 7 - 192
Target Start/End: Original strand, 25430337 - 25430522
Alignment:
| Q |
7 |
agtagcaaaggaaacaaagtgctttcaagcaacaatgatagaccaggtagtttatccatggcatagaatatgtggttgtttgaacaacaaaagtttgtgt |
106 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25430337 |
agtaacaaaagaaacaaagtgctttcaagcaacaatgatagaccaggtagtttatccatggcataaaatatgtggttgtttgaacaacaaaagtttgtgt |
25430436 |
T |
|
| Q |
107 |
caactaagataaaagaaatatggtggttggtgcacttactatgaaagttcttgaagactcgattagcatctgtttgctaggcaagc |
192 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25430437 |
caactaagataaaaaaaatatggtggttggtgcacttactatgaaagttcttgaagactcgattagcatctgcttgctaggcaagc |
25430522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University