View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_low_28 (Length: 340)
Name: NF2557_low_28
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 16 - 327
Target Start/End: Original strand, 45143941 - 45144252
Alignment:
| Q |
16 |
acatacacctcctccaccaacagcttttcttggcaaaccctgaataacctctcccaacaaaccctcttccacaaccttcaacatctcttcagcaccaccg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45143941 |
acatacacctcctccaccaacagcttttcttggcaaaccctgaataacctctcccaacaaaccctcttccacaaccttcaacatctcttcagcaccaccg |
45144040 |
T |
 |
| Q |
116 |
atataatatcccttcacaaacactctcggcggaatcaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatcgaaacgtcac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144041 |
atataatatcccttcacaaacactctcggcggaaccaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatcgaaacgtcac |
45144140 |
T |
 |
| Q |
216 |
gctcgcatatttgtacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttgtatagatcac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144141 |
gctcgcatatttgtacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttgtatagatcac |
45144240 |
T |
 |
| Q |
316 |
cactttcttctc |
327 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45144241 |
cactttcttctc |
45144252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University