View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_low_29 (Length: 328)
Name: NF2557_low_29
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_low_29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 15 - 328
Target Start/End: Complemental strand, 44991075 - 44990762
Alignment:
| Q |
15 |
gaagcagacatgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggaagtacacgaaccaagtctccgg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44991075 |
gaagcagacatgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggtagtacacgaaccaagtctccgg |
44990976 |
T |
|
| Q |
115 |
tgacacatccaaccacttcaatttctggtcaacccaacagttcaatttcttcttgctcttctttagcaccaaactcttttgctgaagaagaagaagacat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990975 |
tgacacatccaaccacttcaatttctggtcaacccaacagctcaatttcttcttgctcttctttagcaccaaactcttttgctgaagaagaagaagacat |
44990876 |
T |
|
| Q |
215 |
cgacatggaaattgaaactgatgatgatggtgaagatagttgtgatattccttcctaaccatgaccaaggaaggtacttggtggtcttcaatcactttca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990875 |
cgacatggaaattgaaactgatgatgatggtgaagatagttgtgatattccttcctaaccatgaccaaggaaggtacttggtggtcttcaatcactttca |
44990776 |
T |
|
| Q |
315 |
cggttgagtttttt |
328 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44990775 |
cggttgagtttttt |
44990762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University