View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_low_43 (Length: 250)
Name: NF2557_low_43
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_low_43 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 250
Target Start/End: Original strand, 193599 - 193842
Alignment:
| Q |
7 |
gtgagatgaatattgaaaactatatatatgctatattatttgtatttttgtggtattccccatatgctcaattatctgctaaatatggcaaaccttgtac |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
193599 |
gtgaaatgaatattgaaaactatatatatgctatattatttgtatttttgtggtattccccgtatgctcaattatctgctaaagatggcaaaccttgtac |
193698 |
T |
 |
| Q |
107 |
taaaaactgcaatcaacattcatcagtttaattatacctcaaattggggtgaggtaggtacatatacctacaagtccaaatgcgtatatataaagatata |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
193699 |
taaaaactgcaatcaacattcatcagtttaattatacctcaaattggggtgaggtaggtacatatacctacaagtccaaatgcgtatatataaggatata |
193798 |
T |
 |
| Q |
207 |
gtgactttctagtgcaccaattgatccagattgcaacctaacat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193799 |
gtgactttctagtgcaccaattgatccagattgcaacctaacat |
193842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University