View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_low_44 (Length: 249)
Name: NF2557_low_44
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_low_44 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 35 - 249
Target Start/End: Original strand, 49635101 - 49635315
Alignment:
| Q |
35 |
tagtccaaaattaaataaagattttgtagggtgcagcttggtaaaagtaccataagcccgtttcatcttaaatgtgctatgaaactccttctcatgtgct |
134 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49635101 |
tagtccaaaattaaataaaaattttgtagggtgcagcttggtaaaagtaccataaacccgtttcatcttaaatgtgctatgaaactccttctcatgtgct |
49635200 |
T |
 |
| Q |
135 |
cactc-tttcacctctcacaagtatttgaaatttgctcttaagacacctaacaagcgtctaaacaataattaactatcgtttgaaacaatttttacatcg |
233 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||| ||| | ||||||||||| |
|
|
| T |
49635201 |
cactcttttcacctctcacaagtatttgaaatttgctcttaagacatttaacaagcgtc-gaacaataattaactaccgtttaaaatattttttacatcg |
49635299 |
T |
 |
| Q |
234 |
gttaaactgacttaac |
249 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
49635300 |
gttaaactaacttaac |
49635315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University