View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2557_low_48 (Length: 238)
Name: NF2557_low_48
Description: NF2557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2557_low_48 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 142 - 238
Target Start/End: Complemental strand, 9965098 - 9965002
Alignment:
| Q |
142 |
gaatttcaaatcagatgcacggagaatctaccgcaataccttagttgaggatgttttgatattgaacttgtagaagataaagattacgtctcatcac |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9965098 |
gaatttcaagtcagatgcacggagaatctaccacaataccttagttgaggttgttttgatattgaacttgtagaagataaagattgcgtctcatcac |
9965002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 9965188 - 9965127
Alignment:
| Q |
18 |
taaaattcatatgtttttaggggaaaaacaattaaatgaagaacattcattataattttaga |
79 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9965188 |
taaaattcatatatttttaggggaaaaacaattaaatgaagaacattcattataattttaga |
9965127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University