View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2558_high_9 (Length: 307)
Name: NF2558_high_9
Description: NF2558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2558_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 11269709 - 11269997
Alignment:
| Q |
1 |
ttccttgtaccaaggccatgacaatgaaaatggaagaagcaaaacatagtataaggtaaacactcaccacaaatttcattgnnnnnnnagtgatgtgtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11269709 |
ttccttgtaccaaggccatgacaatgaaaatggaagaagcaaaacatagtataaggtaaacactcaccacaaatttcattgtttttttagtgatgtgtta |
11269808 |
T |
|
| Q |
101 |
tgatatgatatgtttctgacttgccactaaggctttctatatatggctaccaatatttcatacattaattattttatgcatagaacatattaactagctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11269809 |
tgatatgatatgtttctgacttgccactaaggctttctatatatggctaccaatatttcatacattaattattttatgcatagaacatattaactagctc |
11269908 |
T |
|
| Q |
201 |
aacttgacttatcattgctgtttaatttaatagtactatgataatggttgcattgttgcgccgatttagtgcttggacaaatccttttc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11269909 |
aacttgacttatcattgctgtttaatttaatagtactatgataatggttgcattgttgcgccgatttagtgcttggacaaatccttttc |
11269997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University