View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2559_high_2 (Length: 366)
Name: NF2559_high_2
Description: NF2559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2559_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 3e-33; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 158 - 254
Target Start/End: Original strand, 40618155 - 40618251
Alignment:
| Q |
158 |
ggttcgttgatattttaaaatcatttatagtttgagacaatattcttatgtaaagtgagtacaattcgagacagagaagtattatcattatccactc |
254 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |||||||||||| |
|
|
| T |
40618155 |
ggttcgttgatattttaaaatcatctatagtttgagacaatatttttatgtaaagtgagtacaattcgggacagaggagtattgacattatccactc |
40618251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 2 - 73
Target Start/End: Original strand, 40618000 - 40618071
Alignment:
| Q |
2 |
atatttttggcatgtcatacaagagaaatatacttagttttagatgggaaagataaattatgaattatttta |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40618000 |
atatttttggcatgtcatacaagagaaatatacttaattttagatgggaaagataaattatgaattgtttta |
40618071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 269 - 353
Target Start/End: Original strand, 40618274 - 40618350
Alignment:
| Q |
269 |
aggtaatcttattttttggttgagccgagtattccttgcacttcatccaattttaaggttcaaatattagttgcgcttttctcct |
353 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40618274 |
aggtaatcttgttttttggttgagcc--------cttgcacttcttccaattttaaggttcaaatattagttgtgcttttctcct |
40618350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University