View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2559_high_3 (Length: 361)
Name: NF2559_high_3
Description: NF2559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2559_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 9 - 332
Target Start/End: Original strand, 401746 - 402069
Alignment:
| Q |
9 |
gatatgaaactgaatataggacatcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaagacttcagaggtt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401746 |
gatatgaaactgaatataggacatcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaagacttcagaggtt |
401845 |
T |
 |
| Q |
109 |
tgttccacctgaaagggttcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcatctcataaataca |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401846 |
tgttccatctgaaagggttcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcatctcataaataca |
401945 |
T |
 |
| Q |
209 |
atctcgattttattcccagttaaaccagccggcttcaagcaattgagagagnnnnnnnnggtcttccaacacccttcaaacacagaaaccaattgtttgg |
308 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401946 |
atctcgattttatccacagttaaaccagccggcttcaagcaattgagagagttttttttggtcttccaacacccttcaaacacagaaaccaattgtttgg |
402045 |
T |
 |
| Q |
309 |
gttagcagcctcccagcacaccat |
332 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
402046 |
gttagcagcctcccagcacaccat |
402069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University