View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2559_high_4 (Length: 350)
Name: NF2559_high_4
Description: NF2559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2559_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 76 - 337
Target Start/End: Complemental strand, 3916167 - 3915906
Alignment:
| Q |
76 |
attaggaccttaagttaactttttgatactatacttccccttttctttagcagaatttgaagaaaaaataatctaatagagtttgatgctaaagttacat |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3916167 |
attaggaccttaagttaactttttgatactatacttccccttttctttagcagaatttgaagaaaaaataatctaatagagtttgatgctaaaattacat |
3916068 |
T |
 |
| Q |
176 |
ctcagtgtttcgttcatctgattattgtttgtgtttttatcaaacgcagtggcttgaaagtgttgtgtctgctgcccttaggaagaaaagcggtgaagaa |
275 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3916067 |
ctcagtgtttcattcatctgattattgtttgtgtttttatcaaacgcagtggcttgaaagtgttgtgtctgctgcccttaggaagaaaagtggtgaagaa |
3915968 |
T |
 |
| Q |
276 |
agacaactcatcaactcaaaatttggtattattgattcccaaccccttgtctgctttgccct |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3915967 |
agacaactcatcaactcaaaatttggtattattgattcccaaccccttgtctgctttgccct |
3915906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University