View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2559_low_20 (Length: 209)
Name: NF2559_low_20
Description: NF2559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2559_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 46681142 - 46681023
Alignment:
| Q |
1 |
ttgactattagattttaannnnnnngacagaatgtggatggtttgaatagacaaa-tatggtgatgtatatacgtacttttgttgtgggaagatctttgg |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46681142 |
ttgactattagattttaatttttttgacagaatgtggattgtttgaatagacaaaatatggtga---------gtacttttgttgtgggaagatctttgg |
46681052 |
T |
|
| Q |
100 |
agaatgctccaagtaaaagggcttgatat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46681051 |
agaatgctccaagtaaaagggcttgatat |
46681023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 68 - 128
Target Start/End: Complemental strand, 46677101 - 46677041
Alignment:
| Q |
68 |
tatacgtacttttgttgtgggaagatctttggagaatgctccaagtaaaagggcttgatat |
128 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
46677101 |
tatacgtacttctgttgtgggaaaatctttggacaatgttccaagtaaaagggcttgatat |
46677041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University