View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2560_high_10 (Length: 240)
Name: NF2560_high_10
Description: NF2560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2560_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 12808037 - 12808259
Alignment:
| Q |
1 |
atattcatagggttagtttgaggctgctgaaaggtaaagttgcaatttccagcaactgaattagagctccacaaactttccattgctttgagattaaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
12808037 |
atattcatagggttagtttgaggctgctgaaaggtaaagttgcaatttccagcaactgaattagagctccataaactttccattgctttaagattaaatc |
12808136 |
T |
 |
| Q |
101 |
cctctccttcaagctgaaaatggagttttgaaccatagaattaatagagaaattaggataatctatactaattgagattaaaaaggcatatatgtataat |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | |||| ||||||||||||||||||||||| || |||||||| |||||| || ||||||| |||||| |
|
|
| T |
12808137 |
cctctccttcaagctgaaaatgcagttttggagcataaaattaatagagaaattaggataacttaatctaattgaaattaaatagacatatatttataat |
12808236 |
T |
 |
| Q |
201 |
ggtataaaatcctttatatattt |
223 |
Q |
| |
|
|||| | || ||||||||||||| |
|
|
| T |
12808237 |
ggtacataaccctttatatattt |
12808259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 128
Target Start/End: Complemental strand, 28475793 - 28475727
Alignment:
| Q |
62 |
tagagctccacaaactttccattgctttgagattaaatccctctccttcaagctgaaaatggagttt |
128 |
Q |
| |
|
|||| |||||||| ||||| || ||||| ||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
28475793 |
tagaactccacaagctttcaatagctttaagattaaatccatctgattcaagctgaaaatgaagttt |
28475727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University