View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2560_high_15 (Length: 214)
Name: NF2560_high_15
Description: NF2560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2560_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 12 - 200
Target Start/End: Original strand, 34810140 - 34810328
Alignment:
| Q |
12 |
gataatacttttactccgatggtgatttcgccggtgaagcttggtgctgatgttgttgttcatagtatctccaagtacatcagtggtggggcagatataa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810140 |
gataatacttttactccgatggtgatttcgccggtgaagcttggtgctgatgttgttgttcatagtatctccaagtacatcagtggtggggcagatataa |
34810239 |
T |
 |
| Q |
112 |
ttgcaggtttgtttgtctttttgccatgttcttcttagttctttctttgtcgattatgaaacatacttaacacgtatctatgataaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810240 |
ttgcaggtttgtttgtctttttgccatgttcttcttagttctttctttgtcgattatgaaacatacttaacacgtatctatgataaagt |
34810328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University