View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2561_low_10 (Length: 316)
Name: NF2561_low_10
Description: NF2561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2561_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 2 - 288
Target Start/End: Complemental strand, 2326043 - 2325756
Alignment:
| Q |
2 |
cagagggttcagttgatgtttgcttgaagagtaacctgaaagttgtacggagaaagtgatagtggaaaggacaatcacagtactcataattcataaacat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2326043 |
cagagggttcagttgatgtttgcttgaagagtaacctgaaagttgtacggagaaagtgatagtggaaaggacaatcacagtactcataattcataaacat |
2325944 |
T |
|
| Q |
102 |
aaataaactgtttcagcaatgcaatatctttcccatgctagcagtacttccacatgc-----aagatgaaactgtttcagataaatactattactatcaa |
196 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2325943 |
aaataaactgtttca-----gtaatatctttcccatgcttgcagtacttccacatgcaagctaagatgaaactgtttcagataaatactattactatcaa |
2325849 |
T |
|
| Q |
197 |
ttcatgtcattgtcgtacaaggtacactctttcaactc-nnnnnnnnatcattgtctagtcttttcaatcttcaccactttacttcacttcac |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2325848 |
ttcatgtcattgtcgtacaaggtacactctttcaactctttttttttatcattgtctagtcttttcaatcttcaccactttacttcacttcac |
2325756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University