View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2561_low_16 (Length: 224)
Name: NF2561_low_16
Description: NF2561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2561_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 51741366 - 51741556
Alignment:
| Q |
20 |
tgtggcttcaggacagattggatatgtggaaaagtttgtgaaagatggaacacaaacagtggaatctttgaaagagattggggacttgtactctttgttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51741366 |
tgtggcttcaggacagattggatatgtggaaaagtttgtgaaagatggaacacaaacagtggaatctttgaaagagattggggacttgtactctttgttt |
51741465 |
T |
|
| Q |
120 |
atagtaggaagaggtggtagaggaaatagttcattaacaataggtatgagtgattgggaagaatgtccagaacttggaacggttggtgatg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51741466 |
atagtaggaagaggtggtagaggaaatagttcattaacaataggtatgagtgattgggaagaatgtccagaacttggaacggttggtgatg |
51741556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 36 - 209
Target Start/End: Original strand, 10202183 - 10202356
Alignment:
| Q |
36 |
attggatatgtggaaaagtttgtgaaagatggaacacaaacagtggaatctttgaaagagattggggacttgtactctttgtttatagtaggaagaggtg |
135 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||| ||||||||| |||| ||||||||||||||| ||| | ||||||||||||||||| |||| |||| |
|
|
| T |
10202183 |
attggatatgtagaaaattttgtgaagaatggaagacaaacagttgaatgtttgaaagagattggtgacatatactctttgtttatagttggaaagggtg |
10202282 |
T |
|
| Q |
136 |
gtagaggaaatagttcattaacaataggtatgagtgattgggaagaatgtccagaacttggaacggttggtgat |
209 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||| | ||||||||| |
|
|
| T |
10202283 |
gtagaggaaatagttcactaacaatagatatgagtgattgggaggaatgtccagaacttggatcagttggtgat |
10202356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University