View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_high_35 (Length: 310)
Name: NF2562_high_35
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 17828077 - 17827965
Alignment:
| Q |
19 |
cacagagagacacaaataacgaataatgaaccctacttgnnnnnnnnagagattgtgacaattgatggttgggtgttaaatgagaccaatatatatttat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17828077 |
cacagagagacacaaataacgaataatgaaccctacttgttttttt-agagattgtgacaattgatggttgggtgttaaatgagaccaatatatatttat |
17827979 |
T |
 |
| Q |
119 |
attcatatgagctg |
132 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17827978 |
attcatatgagctg |
17827965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University