View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2562_high_42 (Length: 277)

Name: NF2562_high_42
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2562_high_42
NF2562_high_42
[»] chr3 (1 HSPs)
chr3 (1-268)||(49272218-49272485)


Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 49272218 - 49272485
Alignment:
1 ttatgttgtgtctttctaagttaattgtatgattgtttatatagagaagcatgtcaggtttaatttggacatgtttatggagtgatggtataaaaaatta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49272218 ttatgttgtgtctttctaagttaattgtatgattgtttatatagagaagcatgtcaggtttaatttggacatgtttatggagtgatggtataaaaaatta 49272317  T
101 agttagtgatattatatatttgccatgagcgccacgcggtactagtttaaaatgaaattttgggaacttcgtggaacacgttgatagaaaaataaacagc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49272318 agttagtgatattatatatttgccatgagcgccacgcggtactagtttaaaatgaaattttgggaacttcgtggaacacgttgatagaaaaataaacagc 49272417  T
201 atcttcatccacaatggacttggtatgatatcccttcatcacgttgacttgtgaataatgatattctt 268  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||    
49272418 atcttcatccacaatggacttggtatggtatcccttcatcacgttgacttgtgaataatgattttctt 49272485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University