View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_high_56 (Length: 247)
Name: NF2562_high_56
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_high_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 9 - 238
Target Start/End: Complemental strand, 36776198 - 36775969
Alignment:
| Q |
9 |
ttctgatcttgtttaattgtattatactgcgagtgtggtaatttgagttattactgcttgaatttgttggaatgtttgttgagagattgtgctaaatttg |
108 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36776198 |
ttctgatcttgtttaattgtattgtactgtgagtgtggtaatttgagttattactgcttgaatttgttggaatgtttgttgagagattgtgcaaaatttg |
36776099 |
T |
 |
| Q |
109 |
tctgattcctttgtgatttgtattgcagaagctattcggcgtttgaaaatcaatagtactcgagacagagatgctgcgcctcaatcaatgccttatccgg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36776098 |
tctgattcctttgtgatttgtattgcagaagctattcggcgtttgaaaatcaatagtactcgagacagagatgctgtgcctcaatcaatgccttatccgg |
36775999 |
T |
 |
| Q |
209 |
atcgacctggtgaacctgactgcgtatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36775998 |
atcgacctggtgaacctgactgcgtatatt |
36775969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University