View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_high_60 (Length: 239)
Name: NF2562_high_60
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_high_60 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 34431840 - 34431618
Alignment:
| Q |
1 |
ttcatctgattaaatcgcattagttatgagtaatttggattcaatacaaaaattaacttaatcgagtgttt-aatcggtttatagtttctgttaatttga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34431840 |
ttcatctgattaaatcgcattagttatgagtaatttggattcaatacaaaaattaacttaatcgagtgttttaatcggtttatagtttctgttaatttga |
34431741 |
T |
|
| Q |
100 |
tttatgtgtttttgttttgattcagtcgaagaaaagaggactttcgttggaagagaagcgagagaagatgcttcagatcttttacgaatcacaagatttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431740 |
tttatgtgtttttgttttgattcagtcgaagaaaagaggactttcgttggaagagaagcgagagaagatgcttcagatcttttacgaatcacaagatttc |
34431641 |
T |
|
| Q |
200 |
tttctggttagttacttccttcc |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34431640 |
tttctggttagttacttccttcc |
34431618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University