View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_high_62 (Length: 235)
Name: NF2562_high_62
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_high_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 33327625 - 33327844
Alignment:
| Q |
1 |
cacgtgccggtgacatgtgccgcgacacgtgcggaggcacagtccagctcgacggttgtttggtgaagtatgacaatgctacttttttgggtgtggagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33327625 |
cacgtgccggtgacatgtgccgcgacacgtgcggaggcacagtccagctcgacggttgtttggtgaagtatgacaatgctacttttttgggtgtggagga |
33327724 |
T |
|
| Q |
101 |
taagaatgttttgttgaaaaggtgtgggccttccgtgggctataatccagaagccatgggatcgagagatgctgtgcttggcgggcttgtgggcttaggt |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33327725 |
taagaatgttttgttgaaaaagtgtgggccttccgtgggctataatccagaagccatgggctcgagagatgctgtgcttggcgggcttgtgggcttaggt |
33327824 |
T |
|
| Q |
201 |
gggccttttagggttggtgg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33327825 |
gggccttttagggttggtgg |
33327844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University