View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_high_63 (Length: 235)
Name: NF2562_high_63
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_high_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 8923740 - 8923816
Alignment:
| Q |
1 |
ccttagaactatcataacttagaacacgaataagcaacaaatttttcctaacaaatcgcagttctctttagctttctacg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8923740 |
ccttagaactatcataacttagaacacgaataagcaacaaatttttcctaac---tcgcagttctctttagctttctacg |
8923816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University