View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_high_71 (Length: 214)
Name: NF2562_high_71
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_high_71 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 12 - 196
Target Start/End: Original strand, 40420438 - 40420620
Alignment:
| Q |
12 |
tgagatgaaggagatggatgtgaatcaaattattaagcaggaaaaatagttatactgcagaatnnnnnnnnntgttatgagtattaatcagagaaattta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||| | ||||||||| |
|
|
| T |
40420438 |
tgagatgaaggagatggatgtgaatcaaattattaagcgggaaaaatagttataccgcagaataaaaaaa--tgttatgagtattactataagaaattta |
40420535 |
T |
 |
| Q |
112 |
aagatggtcaactgttaactaggaaaataatggtacagaaggctacgactattttgatttgactgccacgcaaaaggctagggat |
196 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40420536 |
aagatagtcaactgttaactaggcaaataatggtacagaaggctacgactattttgatttgactgccacggcaaaggctagggat |
40420620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University