View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_14 (Length: 453)
Name: NF2562_low_14
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 16 - 346
Target Start/End: Original strand, 35482119 - 35482449
Alignment:
| Q |
16 |
atctcttctccacaatgaaacgtgctgcagcagcacgttgggaagtggagaggagacgaatttcatataaaacttcagcaccaccgctatcaaagtaaga |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35482119 |
atctcttctccacaatgaaacgcgctgcagcagcacgttgggaagtggagaggagacgaatttcatataaaacttcagcaccaccgctatcaaagtaaga |
35482218 |
T |
 |
| Q |
116 |
tagaatctcttcatcagtgttggcctgtacaagagtgtcacgaacttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35482219 |
tagaatctcttcatcagtgttggcctgtacaagagtgtcacgaacttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttct |
35482318 |
T |
 |
| Q |
216 |
tcaagggtgggaggtgaaaagccttcacggaggagggaagtgatgagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcaatgcgac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35482319 |
tcaagggtgggaggtgaaaagccttcacggaggagggaagtgatgagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcgatgcgac |
35482418 |
T |
 |
| Q |
316 |
ctgggatgtcgaggttgtcgtattttgatgg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35482419 |
ctgggatgtcgaggttgtcgtattttgatgg |
35482449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University